rodZ [2018-02-07 12:33:59]

required for cell shape determination

locus: BSU16910

pI: 4.68

mw: 23.48 kDa

protein length: 213 aa

gene length: 639 bp

function: required for cell shape determination

product: morphogenic protein

essential: yes

synonyms: ymfM

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,761,707 → 1,762,573

Phenotypes of a mutant

• essential [Pubmed|19164570,23879732]
• depletion results in the formation of shorter and rounder cells [Pubmed|23879732]
• depletion results in disturbed formation of asymmetric septa and perturbed [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation [Pubmed|27415800]
• hypersensitivity to sorbic acid stress [Pubmed|27818647]

The protein

[SW|Domains]

• N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) [Pubmed|25503291]

[SW|Localization]

• membrane protein (according to Swiss Prot)

Additional information

• overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) [Pubmed|19164570]
• RodZ is destabilized in a ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]'' mutant [Pubmed|23879732]

Expression and Regulation

Operons

• genes: [gene|725094DC9353EBB5FD603AB389607D8C13DF5F51|ymfK/1]-[gene|9394EA0675DFFCB5F0ECD494C104A66CE13A8EF6|ymfK/2]-[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-B120 (ymfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1119 NBRP B. subtilis, Japan]
• BKE16910 (Δ[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
• BKK16910 (Δ[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC

Labs working on this gene/protein

• [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]

References

• 19164570,21636744,21636745,23879732,25503291,27415800,27818647,29403445